| CARD ID | 2978 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6D2-Zfand3em1Osb | |
| Internal Code | B6D2-Zfand3em1Osb | |
| Submitter | takehara tetsuo | |
| Submitter affiliation or code | Osaka University.Graduate School of Medicine.Department of Gastroenterology and Hepatology | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again. |
|
| Production method | ||
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Zfand3 |
| Gene name | zinc finger, AN1-type domain 3 |
| Allele symbol | Zfand3em1Osb |
| Allele name | zinc finger, AN1-type domain 3; endonuclease-mediated mutaiton 1, |
| MGI | MGI:1096572, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Fw3 | GGATGAGAGGGTATGCTGGG |
| Rv3 | TTCCAGGCTCCCTAACATGG |
| del Fw1 | TAAGTTGGCTTGGAACGCGG |
| del Rv2 | AGTAATGACGGCATGCCAGG |
| Disease name, Applicable field |