| CARD ID | 2973 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6J-Kng1em1Osb | |
| Internal Code | Kng1del/del | |
| Submitter | Horiguchi Yasuhiko | |
| Submitter affiliation or code | Department of Molecular Bacteriology, Research Institute for Microbial Diseases, Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
Person in Charge Yukihiro Hiramatsu Department of Molecular Bacteriology, Research Institute for Microbial Diseases, Osaka University 3-1, Yamada-oka, Suita, Osaka 565-0871, Japan TEL: [+81]-6-66879-8285 FAX: [+81]-6-6879-8283 E-mail: yhiramatsu@biken.osaka-u.ac.jp |
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Kng1 |
| Gene name | kininogen 1 |
| Allele symbol | Kng1em1Osb |
| Allele name | kininogen 1; endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University |
| MGI | MGI:1097705, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Outer Fw | GCAGAGCCATCCTGAGGAAA |
| Outer Rv | ACTCCCCAGCTGCTATCAGA |
| Disease name, Applicable field | Hematology, Neurobiology, infectious, Respiratory System |