| CARD ID | 2972 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Fbxo47em1(Fbxo47-3xFLAG-HA) | |
| Internal Code | Fbxo47-3FH | |
| Submitter | Ishiguro Kei-ichiro | |
| Submitter affiliation or code | Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Fbxo47 |
| Gene name | F-box protein 47 |
| Allele symbol | Fbxo47em1(Fbxo47-3xFLAG-HA) |
| Allele name | |
| MGI | MGI:1920223, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Fbxo47-F4 | TCTGTTCCATCTTCTCCATGCTCAGGC |
| Fbxo47-R3 | TGAAGAGCCAGAACTTGTTTTCCAG |
| Disease name, Applicable field | Reproduction, Cell biology |