| CARD ID | 2895 | |
| Type of strain | Transgenic. | |
| Strain name | C57BL/6-Tg(eR1(+24m)-iC9-tdTomato)3-2 | |
| Internal Code | eR1-iC9#3-2 | |
| Submitter | Osato Motomi | |
| Submitter affiliation or code | International Research Center for Medical Sciences, Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Cancer Science Institute of Singapore, National University of Singapore; International Research Center for Medical Sciences, Kumamoto University |
| Organization code | ||
| Developer | Motomi Osato | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | iC9-2A-tdTomato |
| Gene name | inducible Caspase 9 - 2A - tandem dimeric Tomato fluorescent protein |
| Allele symbol | |
| Allele name | |
| MGI | |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| eR1(+24m)-325FP | CACTGATAACGTGGGCAGCTT |
| mhsp68-175RP | GTGTCCGGTGACGTGATCCTC |
| Author | Ng CE, Yokomizo T, Yamashita N, Cirovic B, Jin H, Wen Z, Ito Y, Osato M. |
| Title | A Runx1 intronic enhancer marks hemogenic endothelial cells and hematopoietic stem cells. |
| Journal | Stem Cells |
| Volume | 28(10) |
| Page | 1869-81 |
| Year | 2010 |
| PMID |
| Disease name, Applicable field | Digestive Disorders, Urology, cancer, Cell biology, Laboratory-animal Science, Development, Molecular biology, Aging, Respiratory System |