| CARD ID | 2881 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Sycp2em1 | |
| Internal Code | SYCP2-Line#17 | |
| Submitter | Ishiguro Kei-ichiro | |
| Submitter affiliation or code | Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Sycp2 |
| Gene name | synaptonemal complex protein 2 |
| Allele symbol | Sycp2em1 |
| Allele name | synaptonemal complex protein 2; endonuclease-mediated mutation 1, |
| MGI | MGI:1933281, |
| Chromosome | 2 (99.81) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| SYCP2-F1 | ATGTATACCTAGAAATGGAACTACATG |
| SYCP2-R1 | CAAAGTATGAAGGTACTAACAATTAAAG |
| SYCP2-R2 | ATACTTGGAGGTCTGGTCTCACTGGC |
| Author | Fujiwara Y., Horisawa-Takada Y., Inoue E., Tani N., Shibuya H., Fujimura S., Kariyazono R., Sakata T., Ohta K., Araki K., Okada Y., Ishiguro K. |
| Title | Meiotic cohesins mediate initial loading of HORMAD1 to the chromosomes and coordinate SC formation during meiotic prophase. |
| Journal | PLOS Genetics |
| Volume | |
| Page | |
| Year | 2020 |
| PMID |
| Disease name, Applicable field | Cell biology, Reproduction |