| CARD ID | 2876 | |
| Type of strain | Transgenic. | |
| Strain name | B6-Tg(Pax7-YFP) | |
| Internal Code | Pax7-YFP | |
| Submitter | Ono Yusuke | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | UNITECH |
| Organization code | ||
| Developer | ||
| Year introduced | 2015 / 10 | |
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | - |
| Gene name | Pax7 |
| Allele symbol | |
| Allele name | |
| MGI | |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | |
| OMIM |
| Pax7 YFP forward primer | AGCGCCGTATGAAGCTTGGG |
| Pax7 YFP reverse primer | AAGGGGACTGAGGTGAGGAGA |
| Author | Kitajima Yasuo, Ono Yusuke |
| Title | Visualization of PAX7 protein dynamics in muscle satellite cells in a YFP knock-in-mouse line |
| Journal | Skelet Muscle |
| Volume | 8(1):26 |
| Page | |
| Year | 2018 |
| PMID |
| Disease name, Applicable field | Physiology, Anatomy, Development, Neurobiology, Metabolism |