| CARD ID | 2781 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Nfatc1tm1 | |
| Internal Code | Nfatc1 variant 3 exon1-specific knockout mice53c | |
| Submitter | Mimura Toshihide | |
| Submitter affiliation or code | Department of Rheumatology and Applied Immunology,Faculty of Medicine, Saitama Medical University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | 2015 / 7 | |
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Nfatc1 |
| Gene name | nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1 |
| Allele symbol | Nfatc1tm1 |
| Allele name | nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1; targeted mutation 1, |
| MGI | MGI:102469, |
| Chromosome | 18 (53.66) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | MicroInjection |
| OMIM |
| target_S | TCCAGTCCCTTCCAAGTTTCCACTC |
| target_R | TCTGGGCTGCGCCGGGGAAACAC |
| Disease name, Applicable field | Immunology, Osteosis |