| CARD ID | 2774 | |
| Type of strain | Transgenic. | |
| Strain name | C57BL/6-Tg(eR1(+24m)iCas9/tdTomato)10 | |
| Internal Code | Tg(eR1(+24m)iCas9/tdTomato)B6-10Me | |
| Submitter | Oike Yuich | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Department of Molecular Biology, University of Occupational and Environmental Health, Japan |
| Organization code | ||
| Developer | Motoyoshi Endo | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | RUNX1 |
| Gene name | eR1(Runx1 enhancer) |
| Allele symbol | |
| Allele name | |
| MGI | MGI:, |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| Gene symbol | CASP9 |
| Gene name | iCaspase-9 |
| Allele symbol | |
| Allele name | |
| MGI | |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| Gene symbol | tdTomato |
| Gene name | tdTomato |
| Allele symbol | |
| Allele name | |
| MGI | |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| mCNE20-325FP | CACTGATAACGTGGGCAGCTT |
| mhsp68-175RP | GTGTCCGGTGACGTGATCCTC |
| Disease name, Applicable field | Development, Molecular biology, Respiratory System, cancer |