| CARD ID | 2760 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Mtss1tm1 | |
| Internal Code | B6-Mtss1tm1 | |
| Submitter | kengaku mineko | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | 2013 / 1 | |
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Mtss1 |
| Gene name | metastasis suppressor 1 |
| Allele symbol | Mtss1tm1 |
| Allele name | metastasis suppressor 1, targeted mutation 1, |
| MGI | MGI:2384818, |
| Chromosome | 15 (25.09) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| A_ - s-neocassette-f | GGAATGAGATCCGCTTTCCC |
| B_ - s-neocassette-r | TCAAGCTGCAAGTGCCAGCT |
| Author | Kawabata Galbraith K |
| Title | MTSS1 Regulation of Actin-Nucleating Formin DAAM1 in Dendritic Filopodia Determines Final Dendritic Configuration of Purkinje Cells. |
| Journal | |
| Volume | |
| Page | |
| Year | |
| PMID |
| Disease name, Applicable field | Development, Cell biology |