| CARD ID | 2740 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Gm4969em3 | |
| Internal Code | Gm4969 (del6-14) crispr-ssODN #21 | |
| Submitter | Ishiguro Kei-ichiro | |
| Submitter affiliation or code | Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Gm4969(Meiosin) |
| Gene name | predicted gene 4969 |
| Allele symbol | Gm4969(StIP1) em3 |
| Allele name | predicted gene 4969, endonuclease-mediated mutation 3, |
| MGI | MGI:3647482, |
| Chromosome | 7 (9.46) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Gm4969-29909R | gggTGTCAAAGTATAGAAGCAAAATGC |
| Gm4969-22787F | AAGAAGAAGTTTACCCGAGTGTCAG |
| Gm4969-29605F | CCAGAGAGGAAATGTATTTACTGATCC |
| Author | Kei-ichiro Ishiguro, Kumi Matsuura, Naoki Tani, Naoki Takeda, Shingo Usuki, Mariko Yamane, Michihiko Sugimoto, Sayoko Fujimura, Mihoko Hosokawa, Shinichiro Chuma, Minoru S.H. Ko, Kimi Araki and Hitoshi Niwa |
| Title | MEIOSIN directs the switch from mitosis to meiosis in mammalian germ cells |
| Journal | Developmental Cell |
| Volume | |
| Page | |
| Year | |
| PMID |
| Disease name, Applicable field |