Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank

Mouse strain

Strain information

CARD ID 2731
Type of strain Transgenic.
Strain name C57BL/6-Tg(CAG-FGF23)3
Internal Code C57BL/6-Tg(Fgf23)-3
Submitter Kidoya Hiroyasu
Submitter affiliation or code Kidoya Lab, Department of Integrative Vascular Biology, Faculty of Medical Sciences, University of Fukui
Stock Type
Material Transfer Conditions Consent to us
Production method
Origin (In-house) Organization Kidoya Lab, Department of Integrative Vascular Biology, Faculty of Medical Sciences, University of Fukui
Organization code
Developer Hiroyasu Kidoya
Origin (From other organizations) Organization
Organization code
Year introduced
Introduced Generation

Gene information

Gene symbol FGF23
Gene name fibroblast growth factor 23
Allele symbol
Allele name
MGI MGI:1891427,
Gene classification Gene to express(transgenic)
Method MicroInjection

PCR Primer 1
FGF23TG S tagagcctatccggacactt
FGF23TG AS agagcaggatacaggcacag

Disease , Applicable field information

Disease name, Applicable field cancer

Copyright @ 2021 Kumamoto University. All rights reserved.