| CARD ID | 2730 | |
| Type of strain | Insertion mutant. | |
| Strain name | C57BL/6-Mbpem1Nn | |
| Internal Code | Golli-MBP flox mouse | |
| Submitter | Haruko Miyazaki | |
| Submitter affiliation or code | Department of Molecular Biology and Biochemistry, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Doshisha University |
| Organization code | ||
| Developer | Nobuyuki Nukina | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Mbp |
| Gene name | Myelin basic protein |
| Allele symbol | Mbpem1Nn |
| Allele name | myelin basic protein; endonuclease-mediated mutation 1, Laboratory for Structural Neuropathology, RIKEN Brain Science Institute, |
| MGI | MGI:96925, |
| Chromosome | |
| Gene classification | Other gene(mutant etc.) |
| Method | Electroporation |
| OMIM |
| Golli-flox-FW1 | ATCTTTCCCTGAGAGCCCAG |
| Golli-flox0RV1 | ATCCCATGATCCACAGTAGTC |
| Golli-flox-FW2 | TCATGGCCTGGAAGCAAGTG |
| Golli-flox-RV2 | AGTCCAGTGGATCACAGGTG |
| Author | Miyazaki H, Nishioka S, Yamanaka T, Abe M, Imamura Y, Miyasaka T, Kakuda N, Oohashi T, Shimogori T, Yamakawa K, Ikawa M, Nukina N. |
| Title | Generation and characterization of cerebellar granule neurons specific knockout mice of Golli-MBP |
| Journal | Transgenic Research |
| Volume | |
| Page | |
| Year | 2024 |
| PMID | 38684589 |
| Disease name, Applicable field | Neurobiology, Cell biology, Laboratory-animal Science, Development, Molecular biology |