| CARD ID | 2691 | |
| Type of strain | Targeted mutant. | |
| Strain name | 129S6/SvEv-Vps13atm1asan | |
| Internal Code | 129S6/SvEv-ChAc | |
| Submitter | Sano Akira | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | ||
| Origin (In-house) | Organization | Kagoshima University Graduate School of Medical and Dental Sciences |
| Organization code | ||
| Developer | Akira Sano | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | vps13a |
| Gene name | Vacuolar Protein Sorting 13 Homolog A |
| Allele symbol | vps13atm1asan |
| Allele name | vacuolar protein sorting 13A; targeted mutation 1, Akira Sano |
| MGI | MGI:2444304, |
| Chromosome | 19 (11.71) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| wild-F | ACAATGCCAAGAGAATAGAGTT |
| Neo-F | TTGTCAAGACCGACCTGTCC |
| intR-S | GGGCCCCTAATGAAGAGAAA |
| Author | Sakimoto H, Nakamura M, Nagata O, Yokoyama I, Sano A |
| Title | Phenotypic abnormalities in a chorea-acanthocytosis mouse model are modulated by strain background. |
| Journal | |
| Volume | |
| Page | |
| Year | |
| PMID |
| Author | Tomemori Y, Ichiba M, Kusumoto A, Mizuno E, Sato D, Muroya S, Nakamura M, Kawaguchi H, Yoshida H, Ueno S, Nakao K, Nakamura K, Aiba A, Katsuki M, Sano A. |
| Title | A gene-targeted mouse model for chorea-acanthocytosis. |
| Journal | |
| Volume | |
| Page | |
| Year | |
| PMID |
| Disease name, Applicable field |