| CARD ID | 2681 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Rec8tm1(3xFLAG-HA-GFP) | |
| Internal Code | REC8 KI | |
| Submitter | Ishiguro Kei-ichiro | |
| Submitter affiliation or code | Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Rec8 |
| Gene name | REC8 meiotic recombination protein |
| Allele symbol | |
| Allele name | |
| MGI | MGI:1929645, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| 68_Rec8-Left2-F | GTCGACTGAGCAAGTTCATTAAACCATATCCTG |
| 85_Rec8-Rightarm-R | GCGGCCGCTCTTGAAGCTGACATCTTTGGTTAC |
| Author | Horisawa-Takada Y, Kodera C, Takemoto K, Sakashita A, Horisawa K, Maeda R, Shimada R, Usuki S, Fujimura S, Tani N, Matsuura K, Akiyama T, Suzuki A, Niwa H, Tachibana M, Ohba T, Katabuchi H, Namekawa S, Araki K, Ishiguro K. |
| Title | Meiosis-specific ZFP541 repressor complex promotes developmental progression of meiotic prophase towards completion during mouse spermatogenesis |
| Journal | Nature Communications |
| Volume | 12, 3184 |
| Page | DOI : 10.1038/s41467-021-23378-4 |
| Year | 2021 |
| PMID |
| Disease name, Applicable field | Cell biology, Molecular biology |