| CARD ID | 2659 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Creb3l1tm1 | |
| Internal Code | Oasis-f | |
| Submitter | Araki Kimi | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Creb3l1 |
| Gene name | cAMP responsive element binding protein 3-like 1 |
| Allele symbol | Creb3l1tm1 |
| Allele name | cAMP responsive element binding protein 3-like 1; targeted mutation 1, |
| MGI | MGI:1347062, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| neo-F | aga ggc tat tcg gct atg ac |
| Oasis-3arm-r1 | TTTGAGTGCTCTGCTGCATCTA |
| Disease name, Applicable field | Endocrine Disorders |