| CARD ID | 2642 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Meikintm1 | |
| Internal Code | Meikin Ex6 (+/-) | |
| Submitter | Ishiguro Kei-ichiro | |
| Submitter affiliation or code | Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Kei-ichiro Ishiguro |
| Organization code | ||
| Developer | Institute of Molecular Embryology and Genetics, Kumamoto University | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Meikin |
| Gene name | meiotic kinetochore factor |
| Allele symbol | Meikintm1 |
| Allele name | meiotic kinetochore factor; targeted mutation 1, |
| MGI | MGI:1922097, |
| Chromosome | 11 (32.13) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| Ex3F (common-forward) | CCCCAGAGGAAAAGACACCACC |
| Ex4R (wild-type-reverse) | CTCGACAACAAGCTGTCCATCTC |
| Ex3F (common-forward) | CCCCAGAGGAAAAGACACCACC |
| Neo4R (mutant-reverse) | CATGAGTGGGAGGAATGAGCTGGC |
| Author | Kim J, Ishiguro K., Nambu A., Akiyoshi B., Yokobayashi S., Kagami A., Ishiguro T., Pendas A.M., Takeda N., Sakakibara Y., Kitajima T.S., Tanno Y., Sakuno T., Watanabe Y. |
| Title | Meikin is a conserved regulator of meiosis-I-specific kinetochore function |
| Journal | Nature |
| Volume | 517 |
| Page | 466-471 |
| Year | 2015 |
| PMID |
| Disease name, Applicable field | Molecular biology, Development, Cell biology, Reproduction |