CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2638
Type of strain Targeted mutant.
Strain name C57BL/6-Skp1tm1(Skp1/3xFLAG-HA)
Internal Code Skp1-3FH KI
Submitter Ishiguro Kei-ichiro
Submitter affiliation or code Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University
Stock Type
Material Transfer Conditions Consent to us
Collaboration permission is required for usage of this line
Production method in-house breeding
Origin (In-house) Organization Department of Chromosome Biology Institute of Molecular Embryology and Genetics, Kumamoto University
Organization code
Developer Kei-ichiro Ishiguro
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Skp1a
Gene name S-phase kinase-associated protein 1A
Allele symbol Skp1tm1(Skp1/3xFLAG-HA)
Allele name S-phase kinase-associated protein 1A, targeted mutation 1,
MGI MGI:103575,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
Skp1-75F (SKP1onL2_F2) ATCATTGTTCCCAGGTGGAG
Skp1-76R (SKP1onRight_R1) GACTAGAACAAGATGACAGG


Disease , Applicable field information

Disease name, Applicable field Molecular biology, Cell biology






Copyright @ 2021 Kumamoto University. All rights reserved.