| CARD ID | 2625 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-M1apem2 | |
| Internal Code | M1ap- Ex1crispr 20ins | |
| Submitter | Ishiguro Kei-ichiro | |
| Submitter affiliation or code | Department of Chromosome Biology, Institute of Molecular Embryology and Genetics,Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | M1ap |
| Gene name | Meiosis 1 associated protein |
| Allele symbol | M1apem2 |
| Allele name | Meiosis 1 associated protein, endonuclease-mutation 2, |
| MGI | MGI:1315200, |
| Chromosome | 6 (35.94) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| M1ap-19439F | ACCTGATCCAATTTTATGAAAGCCAGTC |
| M1ap-19851R | CAACTGTGAGTTCTGCTATGGAAATCTC |
| Disease name, Applicable field | Cell biology, Reproduction |