| CARD ID | 2621 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6D2-Dnaic1em1(S124A,S127A)Osb | |
| Internal Code | Dnaic1 S124A S127A KI | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Dnaic1 |
| Gene name | dynein, axonemal, intermediate chain 1 |
| Allele symbol | Dnaic1em1(S124A,S127A)Osb |
| Allele name | dynein, axonemal, intermediate chain 1, endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University |
| MGI | MGI:1916172, |
| Chromosome | 4 (21.75) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| Dnaic1Fw | AAGAATTCCAAAGACTCAGATGAAGGCCGT |
| Dnaic1Rv | AAGGATCCCCCTGACCTGGTGAAATGGGTA |
| Author | Young SA, Miyata H, Satouh Y, Kato H, Nozawa K, Isotani A, Aitken RJ, Baker MA, Ikawa M. |
| Title | CRISPR/Cas9-Mediated Rapid Generation of Multiple Mouse Lines Identified Ccdc63 as Essential for Spermiogenesis. |
| Journal | Int J Mol Sci. |
| Volume | 16 |
| Page | 24732-50 |
| Year | 2015 |
| PMID |
| Disease name, Applicable field |