| CARD ID | 2618 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6D2-Ppp3r2em1Osb | |
| Internal Code | Ppp3r2 KO | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Ppp3r2 |
| Gene name | protein phosphatase 3, regulatory subunit B, alpha isoform (calcineurin B, type II) |
| Allele symbol | Ppp3r2em1Osb |
| Allele name | protein phosphatase 3, regulatory subunit B, alpha isoform (calcineurin B, type II), endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University |
| MGI | MGI:107171, |
| Chromosome | 4 (26.75) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| Ppp3r2Fw | AAGAATTCCCAGGCCAACGGTAGCACGG |
| Ppp3r2Rv | AAGGATCCAAACTCACACAAACACGACC |
| Disease name, Applicable field |