| CARD ID | 2596 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6D2;B6-Izumo1rem1Osb | |
| Internal Code | Izumo1r (Juno) KO | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Others
The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again. |
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Izumo1r |
| Gene name | IZUMO1 receptor, JUNO |
| Allele symbol | Izumo1rem1Osb |
| Allele name | IZUMO1 receptor, JUNO, endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University |
| MGI | MGI:1929185, |
| Chromosome | 9 (4.42) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| CCCCTGTTGGTCAGTTTGCTTTCTACATTC | |
| GGAATGTTCCTCCTCCCACAGCC |
| Author | Kazuki Kato, Yuhkoh Satouh, Hiroshi Nishimasu, Arisa Kurabayashi, Junko Morita, Yoshitaka Fujihara, Asami Oji, Ryuichiro Ishitani, Masahito Ikawa & Osamu Nureki |
| Title | Structural and functional insights into IZUMO1 recognition by JUNO in mammalian fertilization |
| Journal | Nature Communications |
| Volume | 15 |
| Page | 12198 |
| Year | 2016 |
| PMID |
| Disease name, Applicable field |