| CARD ID | 2576 | |
| Type of strain | Transgenic., Targeted mutant. | |
| Strain name | C57BL/6-Cyp19a1tm1(EGFP) | |
| Internal Code | EGFP-ArKO | |
| Submitter | TODA Katsumi | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
No condition
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Dep.Biochemistry,school of Medicine,Kochi University |
| Organization code | ||
| Developer | Katsumi Toda | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | - |
| Gene name | - |
| Allele symbol | |
| Allele name | |
| MGI | |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | |
| OMIM |
| Gene symbol | Cyp19a1 |
| Gene name | cytochrome P450, family 19, subfamily a, polypeptide 1 |
| Allele symbol | Cyp19a1tm1(EGFP) |
| Allele name | cytochrome P450, family 19, subfamily a, polypeptide 1; targeted mutation 1, |
| MGI | MGI:88587, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Maro8 | GCAGCCCCTGACACCATGTC |
| Maro2 | AACTTTCATCATCACCATGGCGATGTACTT |
| Author | Katsumi Toda, Yasushi Okada, Mohamad Zubair, Ken-Ichiro Morohashi, Toshiji Saibara, Teruhiko Okada |
| Title | Aromatase-knockout mouse carrying an estrogen-inducible enhanced green fluorescent protein gene facilitates detection of estrogen actions in vivo |
| Journal | Endocrinology |
| Volume | 145 |
| Page | 1800-1888 |
| Year | 2004 |
| PMID |
| Disease name, Applicable field | Neurobiology, Dermatology, cancer, Immunology, Development, Anatomy, Physiology, Metabolism |