| CARD ID | 2570 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Hnf4atm1 | |
| Internal Code | Hnf4a(1a)tm1(Ky3685) | |
| Submitter | Ken-ichi YAMAMURA | |
| Submitter affiliation or code | Center for Animal Resources and Development Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
Kazuya Yamagata 1-1-1 Honjo, Chuo-ku, Kumamoto Faculty of Life Sciences Kumamoto University |
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Hnf4a |
| Gene name | hepatic nuclear factor 4, alpha |
| Allele symbol | Hnf4atm1 |
| Allele name | hepatic nuclear factor 4, alpha, targeted mutation 1, |
| MGI | MGI:109128, |
| Chromosome | 2 (84.32) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation electroporation |
| OMIM |
| hnf4a1a-l | TCAGCCTATAGGAAACTTTGTAACC |
| neo antisense | AGGTGAGATGACAGGAGATC |
| Disease name, Applicable field | Metabolism |