| CARD ID | 2566 | |
| Type of strain | Transgenic. | |
| Strain name | ICR-Tg(Gad1-CrePR) | |
| Internal Code | GAD67-CrePR knock-in mice | |
| Submitter | Esumi Shigeyuki | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Others
If you use GAD67(Gad1)-CrePR mouse, please contact Prof. Kenji Sakimura for MTA. |
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | Brain Research Institute, Niigata University |
| Organization code | ||
| Developer | Prof.Kenji Sakimura | |
| Year introduced | 2012 / 10 | |
| Introduced Generation | 6 | |
| Remarks | ||
| Gene symbol | Gad1 |
| Gene name | Glutamate decarboxylase 1 |
| Allele symbol | Tg(Gad1-Cre) |
| Allele name | transgene insertion |
| MGI | |
| Chromosome | 2 , |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| Cre F | ACGGCAAGCTGACCCTGAAG |
| Cre R | CTTGTGCCCCAGGATGTTGC |
| Author | Mika Tsujita,1 Hisashi Mori, Masahiko Watanabe, Misao Suzuki, Jun-ichi Miyazaki and Masayoshi Mishina |
| Title | Cerebellar Granule Cell-Specific and Inducible Expression of Cre Recombinase in the Mouse |
| Journal | The Journal of Neuroscience |
| Volume | 19(23) |
| Page | 10318–10323 |
| Year | 1999 |
| PMID |
| Disease name, Applicable field | Neurobiology, Metabolism |