| CARD ID | 2556 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Neurod6tm1(cre) | |
| Internal Code | NEX(Neurod6)-cre | |
| Submitter | Esumi Shigeyuki | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
If you use NEX(Neurod6)-Cre mouse, please contact to Prof. Klaus-Armin Nave in Max Planck Institute for MTA. |
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | Max Planck Institute for Experimental Medicine, Göttingen |
| Organization code | ||
| Developer | Prof. Klaus-Armin Nave Ph.D. | |
| Year introduced | 2005 / 4 | |
| Introduced Generation | 10 | |
| Remarks | ||
| Gene symbol | Neurod6 |
| Gene name | neurogenic differentiation 6 |
| Allele symbol | Neurod6tm1(cre) |
| Allele name | neurogenic differentiation 6, targeted mutation 1, |
| MGI | MGI:106593, |
| Chromosome | 6 (27.53) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Cre F (e26) | tcgatgcaacgagtgatgag |
| Cre R (e27) | ttcggctatacgtaacaggg |
| Author | Sandra Goebbels, Ingo Bormuth, Ulli Bode, Ola Hermanson, Markus H. Schwab, Klaus-Armin Nave |
| Title | Genetic targeting of principal neurons in neocortex and hippocampus of NEX-Cre mice |
| Journal | GENESIS |
| Volume | 44(12) |
| Page | 611-21 |
| Year | 2006 |
| PMID |
| Author | Wu SX, Goebbels S, Nakamura K, Nakamura K, Kometani K, Minato N, Kaneko T, Nave KA, Tamamaki N. |
| Title | Pyramidal neurons of upper cortical layers generated by NEX-positive progenitor cells in the subventricular zone. |
| Journal | Proc Natl Acad Sci U S A |
| Volume | 102(47) |
| Page | 17172-7 |
| Year | 2005 |
| PMID |
| Disease name, Applicable field | Molecular biology, Cell biology, Neurobiology, Hematology, Ophthalomology |