| CARD ID | 2538 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6D2-Gm5617em1Osb | |
| Internal Code | Gm5617 KO em1 | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Others
The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again. |
|
| Production method | ||
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Gm5617 |
| Gene name | predicted gene 5617 |
| Allele symbol | Gm5617em1Osb |
| Allele name | predicted gene 5617, endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University |
| MGI | MGI:3643566, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| GM5617-F-EcoRI | AAGAATTCTTGGTAACGGTTGCGTCTGAC |
| GM5617-R-NheI | CTAGCTAGCAGGCATTCGTTCTACGCTGA |
| Author | Miyata H, Castaneda JM, Fujihara Y, Yu Z, Archambeault DR, Isotani A, Kiyozumi D, Kriseman ML, Mashiko D, Matsumura T, Matzuk RM, Mori M, Noda T, Oji A, Okabe M, Prunskaite-Hyyrylainen R, Ramirez-Solis R, Satouh Y, Zhang Q, Ikawa M, Matzuk MM. |
| Title | Genome engineering uncovers 54 evolutionarily conserved and testis-enriched genes that are not required for male fertility in mice. |
| Journal | Proc Natl Acad Sci U S A. |
| Volume | 113(28) |
| Page | 7704-10 |
| Year | 2016 |
| PMID | 27357688 |
| Disease name, Applicable field |