| CARD ID | 2489 | |
| Type of strain | Transgenic. | |
| Strain name | B6D2-Tg(Stra8-Cre)1Osb | |
| Internal Code | Stra8-cre | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Others
|
|
| Production method | ||
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Cre |
| Gene name | Cre |
| Allele symbol | Tg(Stra8-Cre)1Osb |
| Allele name | transgene insertion 1, Research Institute for Microbial Diseases, Osaka University |
| MGI | |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | |
| OMIM |
| 259 | TTCCAGGGCGCGAGTTGATAG |
| 5224 | CTCCAAGGGGGTAAGGTGTAGC |
| Author | Tokuhiro K1, Satouh Y1, Nozawa K1,2, Isotani A1,3,4, Fujihara Y1, Hirashima Y5, Matsumura H1,4, Takumi K1,4, Miyano T5, Okabe M1, Benham AM1,6, Ikawa M1,2,3,4. |
| Title | Calreticulin is required for development of the cumulus oocyte complex and female fertility. |
| Journal | Sci Rep. |
| Volume | 5 |
| Page | 14254 |
| Year | 2015 |
| PMID |
| Disease name, Applicable field |