| CARD ID | 2488 | |
| Type of strain | Transgenic. | |
| Strain name | B6D2-Tg(CAG-flpo)2Osb | |
| Internal Code | CAG-FLPo #2 | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Others
|
|
| Production method | ||
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | FLPo |
| Gene name | FLPo |
| Allele symbol | Tg(CAG-FLPo)2Osb |
| Allele name | transgene insertion 2, Research Institute for Microbial Diseases, Osaka University |
| MGI | |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | |
| OMIM |
| 750 | GCAACGTGCTGGTTGTTGTGCTGTCTCATC |
| 5867 | TCAGATCCGCCTGTTGATGTAGCTG |
| Author | Yamazaki D, Miyata H, Funato Y, Fujihara Y, Ikawa M, Miki H. |
| Title | The Mg2+ transporter CNNM4 regulates sperm Ca2+ homeostasis and is essential for reproduction. |
| Journal | J Cell Sci. |
| Volume | 129(9) |
| Page | 1940-9 |
| Year | 2016 |
| PMID |
| Disease name, Applicable field |