CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2481
Type of strain Targeted mutant.
Strain name C57BL/6N-Capn11tm1Osb/5B
Internal Code Capn11 #5B
Submitter Ikawa Masahito
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Stock Type
Material Transfer Conditions Others
Production method
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Capn11
Gene name calpain 11
Allele symbol Capn11tm1Osb
Allele name calpain 11, targeted mutation 1, Research Institute for Microbial Diseases, Osaka University
MGI MGI:1352490,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method
OMIM

PCR Primer 1
Capn11-both ATGTGCATGTGAGTGCAGTGCCTGT
Capn11-wt ATTTCTGGGCACCACACGGTACAGCAGTT
108 CTTGACGAGTTCTTCTGAGG


References

Author Miyata H, Castaneda JM, Fujihara Y, Yu Z, Archambeault DR, Isotani A, Kiyozumi D, Kriseman ML, Mashiko D, Matsumura T, Matzuk RM, Mori M, Noda T, Oji A, Okabe M, Prunskaite-Hyyrylainen R, Ramirez-Solis R, Satouh Y, Zhang Q, Ikawa M, Matzuk MM.
Title Genome engineering uncovers 54 evolutionarily conserved and testis-enriched genes that are not required for male fertility in mice.
Journal Proc Natl Acad Sci U S A.
Volume 113(28)
Page 7704-10
Year 2016
PMID 27357688


Disease , Applicable field information

Disease name, Applicable field


EGTC

EGTC番号




Copyright @ 2021 Kumamoto University. All rights reserved.