| CARD ID | 2469 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6D2-Dppa1em1Osb | |
| Internal Code | Dppa1 KO | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Others
|
|
| Production method | ||
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | developmental pluripotency associated 1 |
| Gene name | Dppa1 |
| Allele symbol | Dppa1em1Osb |
| Allele name | developmental pluripotency associated 1, endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University |
| MGI | MGI:2157522, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| Primer-1 | GTGGCTACTGAGCGGAAAGA |
| Primer-2 | TCCAATGGAATATGGGCCAGT |
| Author | Oji A, Noda T, Fujihara Y, Miyata H, Kim YJ, Muto M, Nozawa K, Matsumura T, Isotani A, Ikawa M. |
| Title | CRISPR/Cas9 mediated genome editing in ES cells and its application for chimeric analysis in mice. |
| Journal | Scientific reports. |
| Volume | 6 |
| Page | 31666 |
| Year | 2016 |
| PMID |
| Disease name, Applicable field |