| CARD ID | 2466 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6D2-Selenovem1Osb | |
| Internal Code | Selenov(BC089491) KO | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Others
|
|
| Production method | ||
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Selenov |
| Gene name | selenoprotein V |
| Allele symbol | Selenov em1Osb |
| Allele name | selenoprotein V, endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University |
| MGI | MGI:3608324, |
| Chromosome | |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| check_F | TCCTCAGTCCGGGCAAACAC |
| check_R | TTAGGGTTGGGGCAGGGACTG |
| Author | Miyata H, Castaneda JM, Fujihara Y, Yu Z, Archambeault DR, Isotani A, Kiyozumi D, Kriseman ML, Mashiko D, Matsumura T, Matzuk RM, Mori M, Noda T, Oji A, Okabe M, Prunskaite-Hyyrylainen R, Ramirez-Solis R, Satouh Y, Zhang Q, Ikawa M, Matzuk MM. |
| Title | Genome engineering uncovers 54 evolutionarily conserved and testis-enriched genes that are not required for male fertility in mice. |
| Journal | Proc Natl Acad Sci U S A. |
| Volume | 113(28) |
| Page | 7704-10 |
| Year | 2016 |
| PMID | 27357688 |
| Disease name, Applicable field |