CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2459
Type of strain Targeted mutant.
Strain name B6D2-Izumo1em1(S346Stop)Osb
Internal Code Izumo1 cyt
Submitter Ikawa Masahito
Submitter affiliation or code Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University
Stock Type
Material Transfer Conditions Others
Production method
Origin (In-house) Organization
Organization code
Developer
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol Izumo1
Gene name izumo sperm-egg fusion 1
Allele symbol Izumo1em1(S346Stop)Osb
Allele name izumo sperm-egg fusion 1, endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University
MGI MGI:1920706,
Chromosome 7 (29.39) ,
Gene classification Targeted or trapped gene(knockout etc.)
Method
OMIM

PCR Primer 1
genotyping Fw GGATGGATGGAAAGGAAACG
genotyping Rv GGAGCCAGAAGTCAGAACCA


References

Author Young SA, Miyata H, Satouh Y, Muto M, Larsen MR, Aitken RJ, Baker MA, Ikawa M
Title CRISPR/Cas9-mediated mutation revealed cytoplasmic tail is dispensable for IZUMO1 function and male fertility
Journal Reproduction
Volume 152 (6)
Page 665-672
Year 2016
PMID


Disease , Applicable field information

Disease name, Applicable field






Copyright @ 2021 Kumamoto University. All rights reserved.