| CARD ID | 2459 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6D2-Izumo1em1(S346Stop)Osb | |
| Internal Code | Izumo1 cyt | |
| Submitter | Ikawa Masahito | |
| Submitter affiliation or code | Animal Resource Center for Infectious Diseases Research Institute for Microbial Diseases Osaka University | |
| Stock Type | ||
| Material Transfer Conditions |
Others
|
|
| Production method | ||
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Izumo1 |
| Gene name | izumo sperm-egg fusion 1 |
| Allele symbol | Izumo1em1(S346Stop)Osb |
| Allele name | izumo sperm-egg fusion 1, endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University |
| MGI | MGI:1920706, |
| Chromosome | 7 (29.39) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| genotyping Fw | GGATGGATGGAAAGGAAACG |
| genotyping Rv | GGAGCCAGAAGTCAGAACCA |
| Author | Young SA, Miyata H, Satouh Y, Muto M, Larsen MR, Aitken RJ, Baker MA, Ikawa M |
| Title | CRISPR/Cas9-mediated mutation revealed cytoplasmic tail is dispensable for IZUMO1 function and male fertility |
| Journal | Reproduction |
| Volume | 152 (6) |
| Page | 665-672 |
| Year | 2016 |
| PMID |
| Disease name, Applicable field |