| CARD ID | 2416 | |
| Type of strain | Transgenic. | |
| Strain name | B6-Tg(Umod-Il1f6) | |
| Internal Code | Umod-Il1f6 | |
| Submitter | Inaba Mutsumi | |
| Submitter affiliation or code | Graduate School of Veterinary Medicine, Hokkaido University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Hokkaido University |
| Organization code | ||
| Developer | Osamu Ichii | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Il1f6 |
| Gene name | interleukin 1,family member 6 |
| Allele symbol | Tg(Umod-Il1f6) |
| Allele name | |
| MGI | |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| F | ATGAGCTGCCTGTTCTGCAC |
| R | TATTAGGACAAGGCTGGTGGGCAC |
| Disease name, Applicable field | Unknown |