| CARD ID | 1154 | |
| Type of strain | Targeted mutant. | |
| Strain name | STOCK Calrtm1Osb | |
| Internal Code | calr-tm2 | |
| Submitter | Masaru Okabe | |
| Submitter affiliation or code | Genome Information Research (enter Osaka University) | |
| Stock Type | ||
| Material Transfer Conditions |
Others
The RECIPIENT must contact the person listed below in the case of application for any patents or commercial use based on the results from the BIOLOGICAL RESOURCES mta-egr@biken.osaka-u.ac.jp (Contact to Masahito Ikawa) |
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | ResearchInstituteforMicrobialDiseases,OsakaUniversit |
| Organization code | Osb | |
| Developer | Masahito Ikawa | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Calr |
| Gene name | calreticulin |
| Allele symbol | Calrtm1Osb |
| Allele name | calreticulin, targeted mutation 1, Research Institute for Microbial Diseases, Osaka University |
| MGI | MGI:88252, |
| Chromosome | 8 (41.21) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| 2621 | gagtggaaaccaggtgaaattgacaacc |
| 2622 | cttctctgataagttttcctctgacctc |
| 2623 | agggttccggatccgatgaagttcc |
| Author | Tokuhiro K1, Satouh Y1, Nozawa K1,2, Isotani A1,3,4, Fujihara Y1, Hirashima Y5, Matsumura H1,4, Takumi K1,4, Miyano T5, Okabe M1, Benham AM1,6, Ikawa M1,2,3,4. |
| Title | Calreticulin is required for development of the cumulus oocyte complex and female fertility. |
| Journal | Sci Rep. |
| Volume | 5 |
| Page | 14254 |
| Year | 2015 |
| PMID |
| Disease name, Applicable field | Physiology, Development, Immunology, Metabolism |