| CARD ID | 240 | |
| Type of strain | Transgenic. | |
| Strain name | BXD-Tg(Hpoc-OSF1) | |
| Internal Code | Bone-rich mouse, HPoc-Hosf1-6 | |
| Submitter | Unknown Unknown | |
| Submitter affiliation or code | ||
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Kyoto Pref. Univ, Med., RINDG, DBMG |
| Organization code | ||
| Developer | Harufumi Masuda & T.Hashimoto-Gotoh | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | OSF1(=PTN) |
| Gene name | Pleiotrophin (heparin binding growth factor 8, neurite growth-promoting factor 1)(Human) |
| Allele symbol | |
| Allele name | |
| MGI | |
| Chromosome | Unknown , |
| Gene classification | Gene to express(transgenic) |
| Method | |
| OMIM | OMIM ID: 162095 Human Gene Symbol: PTN, |
| primerA | 5'(GAAAATTTGCAGCTGCCTTC)3' OSF_U246 |
| primerB | 3'(AACTCGTAGACTGAAGACC)5' TGL542 |
| Author | Haruchika Masuda, Atsushi Tasujimura, Makoto Yoshioka, Yuji Arai, Yoshinori Kuboki, Tsunehiro Mukai, Toshitaka Nakamura, Hajime Tsuji, Masao Nakagawa, and Tamotsu Hashimoto-Gotoh |
| Title | Bone Mass Loss Due to Estrogen Deficiency Is Compensated in Transgenic Mice Overexpressing Human Osteoblast Stimulating Factor-11 |
| Journal | BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS |
| Volume | 238 |
| Page | 528-533 |
| Year | 1997 |
| PMID | 9299545 |
| Author | Hashimoto-Gotoh, T., Masuda, H., Yamaguchi, M., Tsujimura, A., Ohnishi, H., Imai, S., Inoue, K., Nakamura, T., Hirasawa, T. and Nakagawa, M. |
| Title | Feasibility of gene therapy using human OSF1 against osteoporosis |
| Journal | Osteoporosis Japan |
| Volume | 9 |
| Page | 5-7 |
| Year | 2001 |
| PMID |
| Disease name, Applicable field | Metabolism |