CARD R-BASE

Home - Type of strain - Disease - Gene - Reference - Search - Japanese
CARD Mouse Bank


Mouse strain


Strain information

CARD ID 2374
Type of strain Targeted mutant.
Strain name C57BL/6J-Del(3 H2-H4)76S
Internal Code C57BL/6J-Ch3H2-476Stm1Ati
Submitter Yasuharu NISHIMURA
Submitter affiliation or code Kumamoto University Graduate School of Medical Science, Department of Neuroscience and Immunoloy
Stock Type
Material Transfer Conditions Consent to us
Production method in-house breeding
Origin (In-house) Organization Kumamoto Univ. Grad Sch. Med. Sci., Immunogenetics
Organization code
Developer Atsushi Irie
Origin (From other organizations) Organization
Organization code
Developer
Year introduced
Introduced Generation
Remarks


Gene information

Gene symbol -
Gene name -
Allele symbol
Allele name
MGI MGI:,
Chromosome
Gene classification Targeted or trapped gene(knockout etc.)
Method Electroporation
OMIM

PCR Primer 1
7056-7082F GTCTATGGGATGGGATTTGAGTTGGGC
3501-3481R GCATAATATGGTCTGAGAAGC


Disease , Applicable field information

Disease name, Applicable field Unknown






Copyright @ 2021 Kumamoto University. All rights reserved.