| CARD ID | 2372 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;BDF1-Gtsf1ltm1Miya | |
| Internal Code | Gtsf1l KO | |
| Submitter | Miyazaki Jun-ichi | |
| Submitter affiliation or code | Division of Stem Cell Regulation Research,Osaka University Graduate School of Medicine | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | Miya | |
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Gtsf1l |
| Gene name | gametocyte specific factor 1-like |
| Allele symbol | Gtsf1ltm1Miya |
| Allele name | gametocyte specific factor 1-like, targeted mutation 1, |
| MGI | MGI:1915486, |
| Chromosome | 2 (84.04) (2H3) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | MicroInjection, Other |
| OMIM |
| Gtsf1l-Bam-F | aaaggatccgctcttgtacctgcctgagttaacg |
| Gtsf1l-Eco-R | tttgaattctagaagtttgccttcctggtcctag |
| Disease name, Applicable field | Reproduction |