| CARD ID | 2370 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Rbp4tm1(RBP4)Card | |
| Internal Code | mRbp4hRBP4mg | |
| Submitter | Yamamura Ken-ichi | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Rbp4 |
| Gene name | retinol binding protein 4, plasma |
| Allele symbol | Rbp4tm1(RBP4)Card |
| Allele name | retinol binding protein 4, plasma, targeted mutation 1, |
| MGI | MGI:97879, |
| Chromosome | 19 (32.75) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| GSPF1 | CTCGGCTCCGTCGCTCCACG |
| GSPR1 | CCAGAGCCCAGAGAACTGAG |
| Disease name, Applicable field |