| CARD ID | 2361 | |
| Type of strain | Transgenic. | |
| Strain name | C57BL/6-Tg(Cdh5-CreERT2) | |
| Internal Code | Cdh5-BAC-CreERT2 | |
| Submitter | Kubota Yoshiaki | |
| Submitter affiliation or code | School of Medicine, Keio University | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | School of Medicine, Keio University |
| Organization code | ||
| Developer | Yoshiaki Kubota | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Cdh5-CreERT2 |
| Gene name | Cdh5-CreERT2 |
| Allele symbol | |
| Allele name | transgene insertion |
| MGI | |
| Chromosome | Unknown , |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection microinjection |
| OMIM |
| Cre1 | GCGGTCTGGCAGTAAAAACTATC |
| Cre2 | GTGAAACAGCATTGCTGTCACTT |
| Author | Okabe K, Kobayashi S, Yamada T, Kurihara T, Tai-Nagara I, Miyamoto T, Mukouyama YS, Sato TN, Suda T, Ema M and Kubota Y |
| Title | Neurons limit angiogenesis by titrating VEGF in retina |
| Journal | Cell |
| Volume | 159 |
| Page | 584-596 |
| Year | 2014 |
| PMID |
| Disease name, Applicable field | Anatomy, Molecular biology, Development, Cell biology, Diabetes, cancer, Dermatology, Neurobiology, Hematology, Ophthalomology |