| CARD ID | 2359 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Ptger2tm1 | |
| Internal Code | EP2KO(lacZ) | |
| Submitter | Sugimoto Yukihiko | |
| Submitter affiliation or code | Department of Phamaceutical Biochemistry, Graduate School of Phamaceutical Sciences, Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
No condition
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | Yukihiko Sugimoto | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Ptger2 |
| Gene name | prostaglandin E receptor 2 (subtype EP2) |
| Allele symbol | Ptger2tm1 |
| Allele name | prostaglandin E receptor 2 (subtype EP2), targeted mutation 1, |
| MGI | MGI:97794, |
| Chromosome | 14 (22.68) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | |
| OMIM |
| Puro1 | TAATTCCATCAGAAGCTGGTCGACCTCG |
| 2716 | CTGAGCAACACCCATGTTTCTATCCTGG |
| Disease name, Applicable field |