| CARD ID | 2357 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-C2cd4ctm1(LacZ) | |
| Internal Code | C2cd4c deficient mice(Neo minus) | |
| Submitter | Kume Shoen | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Tokyo Institute of Technology |
| Organization code | ||
| Developer | Shoen Kume | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | C2cd4c |
| Gene name | C2 calcium-dependent domain containing 4C |
| Allele symbol | C2cd4ctm1(LacZ) |
| Allele name | C2 calcium-dependent domain containing 4C, targeted mutation 1, |
| MGI | MGI:2685084, |
| Chromosome | 10 (39.72) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | MicroInjection |
| OMIM |
| C2cd4c forward | gtgctcagcgtgatcctaca |
| C2cd4c reverse | ccgaagtcgttccaagaacc |
| C2cd4c null | ccacaacgggttcttctgtt |
| Disease name, Applicable field | Molecular biology, Development, Obesity, Diabetes, Neurobiology, Endocrine Disorders, Metabolism, Reproduction, Digestive Disorders, Ophthalomology |