| CARD ID | 2348 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6.129S6-Gcgtm1Yhys | |
| Internal Code | Gcg-GFP | |
| Submitter | Kume Shoen | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | From other organizations | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | Nagoya University |
| Organization code | ||
| Developer | Yoshitaka Hayashi | |
| Year introduced | 2014 / 8 | |
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Gcg |
| Gene name | glucagon |
| Allele symbol | Gcgtm1Yhys |
| Allele name | glucagon; targeted mutation 1, Yoshitaka Hayashi |
| MGI | MGI:95674, |
| Chromosome | 2 (35.85) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | MicroInjection |
| OMIM |
| Tm1Yhys Common Fw | tgagctcatttggactgcctgc |
| Tm1Yhys WT rev | GGGATATCAATGTAATAACCACAAACGGTA |
| Tm1Yhys NI rev | ATGGTGCGCTCCTGGACGTAG |
| Author | Fukami A, Seino Y, Ozaki N, Yamamoto M, Sugiyama C, Sakamoto-Miura E, Himeno T, Takagishi Y, Tsunekawa S, Ali S, Drucker DJ, Murata Y, Seino Y, Oiso Y, Hayashi Y. |
| Title | Ectopic Expression of GIP in Pancreatic beta-Cells Maintains Enhanced Insulin Secretion in Mice With Complete Absence of Proglucagon-Derived Peptides. |
| Journal | Diabetes |
| Volume | 62(2) |
| Page | 510-8 |
| Year | 2013 |
| PMID |
| Disease name, Applicable field | Development, Diabetes |