| CARD ID | 2339 | |
| Type of strain | Targeted mutant. | |
| Strain name | DBA/2-Mcm3aptm1Imku | |
| Internal Code | ganp-KO (DBA/2) | |
| Submitter | Kuwahara Kazuhiko | |
| Submitter affiliation or code | Aichi Cancer Center Research Institute | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Aichi Cancer Center Research Institute |
| Organization code | ||
| Developer | Kazuhiko Kuwahara | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Mcm3ap |
| Gene name | minichromosome maintenance complex component 3 associated protein |
| Allele symbol | Mcm3aptm1Imku |
| Allele name | minichromosome maintenance complex component 3 associated protein; targeted mutation 1, Nobuo Sakaguchi |
| MGI | MGI:1930089, |
| Chromosome | 10 (38.88) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Neo 5'-int | GCAGCTGTGCTCGACGTTGT |
| Neo 3'-int | GGCGATACCGTAAAGCACGA |
| Author | Mikoto Yoshida, Kazuhiko Kuwahara, Tatsuya Shimasaki, Naomi Nakagata, Masao Matsuoka, and Nobuo Sakaguchi |
| Title | GANP suppresses DNA recombination measured by direct-repeat beta-galactosidase gene-construct but not the immunoglobulin-gene-type recombination in mammalian cells. |
| Journal | Genes to Cells |
| Volume | 12 |
| Page | 1205-1213 |
| Year | 2007 |
| PMID |
| Disease name, Applicable field | Development, cancer |