| CARD ID | 2338 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6;129-Gtsf1tm1Miya | |
| Internal Code | Gtsf1 KO | |
| Submitter | Miyazaki Jun-ichi | |
| Submitter affiliation or code | Division of Stem Cell Regulation Research,Osaka University Graduate School of Medicine | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | Miya | |
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Gtsf1 |
| Gene name | Gametocyte specific factor 1 |
| Allele symbol | Gtsf1tm1Miya |
| Allele name | Gametocyte specific factor 1, targeted mutation 1, |
| MGI | MGI:1921424, |
| Chromosome | 15 (58.93) (15F3) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| 110EX4A3 | TGTTTGTTTGTTTTCATGACAGGGTTTC |
| Puro-S4 | ACCCGCAAGCCCGGTGCCTGA |
| 110INT3S3 | GGGGCACTGTAATAACTTTTCAGGGTCC |
| Author | Yoshimura T, Miyazaki T, Toyoda S, Miyazaki S, Tashiro F, Yamato E, Miyazaki J |
| Title | Gene expression pattern of Cue110: A member of the uncharacterized UPF0224 gene family preferentially expressed in germ cells |
| Journal | Gene Expression Patterns |
| Volume | 8 |
| Page | 27-35 |
| Year | 2007 |
| PMID |
| Author | Yoshimura T, Toyoda S, Kuramochi-Miyagawa S, Miyazaki T, Miyazaki S, Tashiro F, Yamato E, Nakano T, Miyazaki J |
| Title | Gtsf1/Cue110, a gene encoding a protein with two copies of a CHHC Zn-finger motif, is involved in spermatogenesis and retrotransposon suppression in murine testes |
| Journal | Developmental Biology |
| Volume | 335 |
| Page | 216-227 |
| Year | 2009 |
| PMID |
| Disease name, Applicable field | Development, Reproduction |