| CARD ID | 2332 | |
| Type of strain | Transgenic. | |
| Strain name | STOCK-Tg(CAG-mcm3ap)Imku | |
| Internal Code | GANP (CAG) Tg | |
| Submitter | Kuwahara Kazuhiko | |
| Submitter affiliation or code | Aichi Cancer Center Research Institute | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | mcm3ap |
| Gene name | minichromosome maintenance complex component 3 associated protein |
| Allele symbol | Tg(CAG-mcm3ap)Imku |
| Allele name | |
| MGI | |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| mganp1-5' | TCCCGCCTTCCAGCTGTGAC |
| mganp1-3' | GTGCTGCTGTGTTATGTCCT |
| Disease name, Applicable field | cancer |