| CARD ID | 2322 | |
| Type of strain | Targeted mutant. | |
| Strain name | B6-ROSA26Tm(SAWZ)35Card | |
| Internal Code | R26SAWZ-35 | |
| Submitter | Araki Kimi | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | IRDA, Kumamoto University |
| Organization code | Card | |
| Developer | Kimi Araki | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Gt(ROSA)26Sor |
| Gene name | gene trap ROSA 26, Philippe Soriano |
| Allele symbol | |
| Allele name | |
| MGI | MGI:104735, |
| Chromosome | 6 , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| WZ-14 | GCTCTCTACAGGTGGATCAAG |
| WZ-17 | GCAGTTCAATCAGCTGCTTTC |
| Disease name, Applicable field | Others |