| CARD ID | 2262 | |
| Type of strain | Targeted mutant. | |
| Strain name | C57BL/6-Spint1tm1 | |
| Internal Code | hepatocyte growth factor activator inhibitor type1 (HAI-1) hetero mouse | |
| Submitter | Kataoka Hiroaki | |
| Submitter affiliation or code | University of Miyazaki | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Miyazaki University |
| Organization code | ||
| Developer | Kataoka Hiroaki | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | Spint1 |
| Gene name | serine protease inhibitor, Kunitz type 1 |
| Allele symbol | Spint1tm1 |
| Allele name | serine protease inhibitor, Kunitz type 1, targeted mutation 1, |
| MGI | MGI:1338033, |
| Chromosome | 2 (57.97) , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| mHAI-1 F1 | GGGTTCTAGAAGTTCTGTGGGTGTAAGGAT |
| mHAI-1 MR1 | ATTAAGGGTTCCGGATCCTCTAGAGTCGAG |
| Author | Sandra Ryeom, Kwan-Hyuck Baek, Matthew J. Rioth, Ryan C. Lynch, Alexander Zaslavsky, Amy Birsner, Sam S. Yoon, and Frank McKeon |
| Title | Targeted Deletion of the Calcineurin Inhibitor DSCR1 Suppresses Tumor Growth |
| Journal | Cancer Cell |
| Volume | 13 |
| Page | 420-431 |
| Year | 2008 |
| PMID |
| Disease name, Applicable field | Development |