| CARD ID | 2246 | |
| Type of strain | Transgenic. | |
| Strain name | C57BL/6-Tg(Pkd1l3-WGA)3Abek | |
| Internal Code | PKD1L3-WGA | |
| Submitter | Ishimaru Yoshiro | |
| Submitter affiliation or code | Graduate School of Agricultural and Life Sciences, The University of Tokyo | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | ||
| Origin (In-house) | Organization | |
| Organization code | ||
| Developer | ||
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | WGA |
| Gene name | wheat germ agglutinin |
| Allele symbol | |
| Allele name | |
| MGI | |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| 1L3-F2 | acctctccctgcttgcaggtagc |
| WGA-R1 | cgtaagggccatggtgctcatcatctttct |
| Author | Yamamoto K, Ishimaru Y, Ohmoto M, Matsumoto I, Asakura T, Abe K. |
| Title | Genetic tracing of the gustatory neural pathway originating from Pkd1l3-expressing type III taste cells in circumvallate and foliate papillae |
| Journal | Journal of Neurochemistry |
| Volume | 119 |
| Page | 497-506 |
| Year | 2011 |
| PMID |
| Disease name, Applicable field |