| CARD ID | 2242 | |
| Type of strain | Gene trap. | |
| Strain name | B6.Cg-Gt(pU-21T)237Card | |
| Internal Code | Ayu21-T237 | |
| Submitter | Araki Kimi | |
| Submitter affiliation or code | - | |
| Stock Type | ||
| Material Transfer Conditions |
Consent to us
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | IRDA, Kumamoto University |
| Organization code | Card | |
| Developer | Kimi Araki | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | |
| Gene name | |
| Allele symbol | |
| Allele name | |
| MGI | |
| Chromosome | 2 , |
| Gene classification | Targeted or trapped gene(knockout etc.) |
| Method | Electroporation |
| OMIM |
| Z-1 | GCGTTACCCAACTTAATCG |
| Z-2 | TGTGAGCGAGTAACAACCCG |
| Disease name, Applicable field | Unknown |
| EGTC番号 | 21-T237 |