| CARD ID | 2241 | |
| Type of strain | Transgenic. | |
| Strain name | STOCK-Tg(CM-tslc1-IRES-hrGFP)b | |
| Internal Code | TgN(CM-tslc1-IRES-hrGFP)-b | |
| Submitter | Wakayama Tomohiko | |
| Submitter affiliation or code | Kumamoto University | |
| Stock Type | ||
| Material Transfer Conditions |
No condition
|
|
| Production method | in-house breeding | |
| Origin (In-house) | Organization | Kumamoto University |
| Organization code | ||
| Developer | Tomohiko Wakayama | |
| Origin (From other organizations) | Organization | |
| Organization code | ||
| Developer | ||
| Year introduced | ||
| Introduced Generation | ||
| Remarks | ||
| Gene symbol | tsk1 |
| Gene name | tumor suppressor in lung cancer -1 |
| Allele symbol | |
| Allele name | |
| MGI | |
| Chromosome | |
| Gene classification | Gene to express(transgenic) |
| Method | MicroInjection |
| OMIM |
| hrGFP-F | TTCACCAAGTACCCCGAG |
| hrGFP-R | CATGTGGCAGCTGTAGAACT |
| Author | Fujihara Y, Okabe M, Ikawa M |
| Title | GPI-anchored protein complex, LY6K/TEX101, is required for sperm migration into the oviduct and male fertility in mice. |
| Journal | Biol Reprod |
| Volume | 90(3) |
| Page | 60 |
| Year | 2014 |
| PMID |
| Disease name, Applicable field | Anatomy, Development |